about-bg about-bg

Watch/Listen

Fake News

• Greg Boyd

The story of Genesis 3 identifies the lies at the root of all that is wrong with the world. These lies are fake news about the nature of God, ourselves, others and the purpose of the planet. When we buy into these lies, the resulting actions cause destruction.

Show Extended Summary Hide Extended Summary

The story of the Fall of Adam and Eve in Genesis 3 expresses the most fundamental thing that is wrong with human beings. This is our story both individually and collectively, insofar as we are estranged from God. It’s a story of how we humans allowed ourselves to be seduced by the first fake news about the nature of God, about ourselves, others and the planet. This story explains why we treat God, ourselves, other people, and Earth rather poorly.

First let’s consider the lie about God that is the root of the Fall. We know the true God in the crucified Christ. According to the New Testament, the cross demonstrates that God’s very essence is perfect, other-oriented, self-sacrificial love. It is who God is, not just what God does. Everything God does reflects God’s perfect love. The crafty serpent suggested an alternative perspective on God. He enticed Eve to imagine a different story about the nature of God. At the root of everything that is wrong is that we humans believe fake news about the character of Abba Father.

The second lie is the fake news about Eve. The truth is that God created Eve to have the fullest life possible simply by having her life centered on God and overflowing with life back to God, to herself, to other people, and to the Earth and animal kingdom. But the crafty serpent unpacks another aspect of his fake news, suggesting that she was selling herself short by being content in walking with God in cool of the day. He challenged her to do something, to be all she could be and live her best possible life. Because Eve no longer trusted God for her fullness of life, she felt empty, which made her vulnerable to the enemy’s lie that she was not okay as she was. This is true of all of us when we believe the serpent’s lie. We are driven to feel fully alive, significant and secure by what we can do. Because we aren’t leaning on God to be the source of our fullness of life, we’re always yearning for more. This means that whatever gets in my way detracts from my fulfillment, making me feel insecure and insignificant.

When we believe fake news about God, we believe fake news about ourselves. In turn, then, we will also believe fake news about others and the planet.  Eve acts like she is God and can assign worth to things based on how they meet her needs and measure up to her expectations or not. Eve not only became a human doer, she also became the quintessential human consumer. This is the story of all of us, to whatever degree we are conformed to what the apostle Paul called “the pattern of this world.” In this view, everything exists for our consumption, to meet our needs, and on this basis we judge people and things to be good or evil.

Our job is to believe and act on truth. First, we must take great care to make sure we are always imagining the true God as he is revealed in the crucified Christ and therefore purge our minds of all images of God that are not consistent with the image we are given on the cross. We can only truly love God to the degree that our conception of God is lovable. You are already loved and you can fully live into your identity which has been given to you by the God who loves you. The truth about God and about ourselves will help us to see the truth about others and the environment. All have unsurpassable worth, whether we agree with them or not, and we are called to be stewards of the Earth and the animal kingdom.

Hide Extended Summary

Topics: Judgment, Love

Sermon Series: Sermon on the Mount, Cross Examination


Downloads & Resources

Audio File
Study guide
Group Study Guide
The MuseCast: July 19

Focus Scripture:

  • Genesis 3:1-7

    Now the serpent was more crafty than any other wild animal that the Lord God had made. He said to the woman, “Did God say, ‘You shall not eat from any tree in the garden’?” The woman said to the serpent, “We may eat of the fruit of the trees in the garden, but God said, ‘You shall not eat of the fruit of the tree that is in the middle of the garden, nor shall you touch it, or you shall die.’ ” But the serpent said to the woman, “You will not die, for God knows that when you eat of it your eyes will be opened, and you will be like God, knowing good and evil.” So when the woman saw that the tree was good for food and that it was a delight to the eyes and that the tree was to be desired to make one wise, she took of its fruit and ate, and she also gave some to her husband, who was with her, and he ate. Then the eyes of both were opened, and they knew that they were naked, and they sewed fig leaves together and made loincloths for themselves.

Subscribe to Podcast

7 thoughts on “Fake News

  1. Matthew says:

    “First, we must take great care to make sure we are always imagining the true God as he is revealed in the crucified Christ and therefore purge our minds of all images of God that are not consistent with the image we are given on the cross.”

    Do you have any idea how long it took me as a Christian (more than 20 years conservative evangelical) to accomplish this? Man … it has been like pulling a ball of rubberbands apart! But you know … no one could have convinced me through slick argumentation or brilliant presentations to change my views and, also, nothing happened outside of its appropriate time. It was truly a work of the Holy Spirit. Yes … I did a lot of research and studying, and Woodland Hills has played a role in my paradigm shift. Ultimately, though, the question asking that moved me in the direction of finding new ways to understand God and the scriptures came from deep within an inner man that was already regenerated by the love of God in Jesus Christ. I remember sitting in the conservative Baptist church I was attending some years ago. Once again the sermon fill in sheets were handed out. Once again we heard the same message that Jesus Christ died on the cross for our individual sins. I remember, also, standing in the pew and asking myself … man … there has to be more to all this than Jesus Christ died for my sins (as important as that act is). As far as I can tell that was the watershed moment for me, for my theology, for my faith.

    Admittedly I still struggle with parts of scripture that seem to speak more retributively than restorative (like some of the pararbles), and that old parardigm still sneaks up from time to time, but at the end of the day I am better off now than I was 20 years ago. At least I think I am.

  2. Matthew says:

    Can we get an edit button here please? 🙂 🙂

  3. Jerry says:

    Caricature: (from Different kind of fire -comment-248005) you said you are Non-lateral & Divergent. This got me thinking about what my modes of thinking might be. For 25 years after my 1st follow Jesus experience, I didn’t think about science. All I needed to know was Jesus died for my sins and after the rapture, God would deal with the rest.

    Matthew “edit button” I hear you brother. My wife was concerned about my friendship with computers and what appeared to be a dislike for people and got me to go see Al.

    Al and I talked about computing and he saw a correlation between my focus and the science that he had an interest in. He’d say weird stuff like a laser beam is turned into a reference bean that our (VAKOG) brings back as a holographic reference of the event which is real to us but is twisted and distorted by the state of our subconscious operating/belief system. Greg, Paul you remember this? I considered Al was a little more nuts than me however he got me to start reading stuff.

    All known particles of matter can be arranged into three “generations.” In the first generation are the electron, the electron neutrino, and the two quarks called “up” and “down,” which together build protons and neutrons. The particles in this first generation are all essentially stable and go to make up the ordinary matter of the universe that we see. The atoms of your body, and of the sun and stars, are composed of these first-generation particles.

    The other two generations are at this point mysterious for they can only be created in particle accelerators for a brief pico-second moment.

    In the world of atoms, solid matter, the floor upon which you stand, and the foundation that bears the weight of a skyscraper is actually 99.9999999999999 percent vacuous space made to feel solid by ethereal fields of force having no material reality at all.

    Seriously; I’m pretty sure if I ran my vehicle into it I’d be in a world of hurt. To read this is one thing, accepting it’s true because well someone won a Nobel Prize, but to actually experience something unusual 1st and then be informed what it means would add a whole lot more meaning as a personal experience.

    In the early ’70s at the same time I was working, with IBM, on my artificial intelligence template I was doing some experimentation, before Nixon outlawed its clinical use, with mind-expanding drugs. On a particular day, I was given some high-grade clinical LSD and instructed to just remember to keep my eyes on the road. I got in my car parked in front of the Commodore hotel and as I started driving I was just blown away by the summer colors. At about one block I stopped at the corner, started tripping out and all I saw was a beautiful kaleidoscope of pixels of color. Stopped at the corner this went on and on, it seemed like fore ever.

    All of a sudden I came out of it but I was not at the corner. I was sitting at a light, about a block from Central High on Dale about a mile from my start, which was green.

    My first thought was how long was I sitting there. I did not hear any horns or police sirens and when I looked in my rearview mirror there were several cars however the face of the driver behind me did not look angry so I just pressed the accelerator and I started tripping out again. Again it was beautiful pixels of color and it seemed to go on forever but when I came out again I was only halfway through that same intersection.

    I began navigating traffic for the next half mile until I got on the Dale cross-over for Interstate 94. With heavy traffic on all four sides, I felt very enclosed and paranoid. I started tripping again but was able to come out of what might have ended in a bad trip.

    I never really tried to figure the trip out until, from reading Eric Kandels’ book, “In Search of Memory” for which he won a Nobel Prize, it dawned on me that all the automated processes stored in your brain only require pixels. We are projecting our reality first, and then perceiving it coming back to us. Only later is an image created, in the back of our brain, and projected for the convenience of our spirit. The LSD was blocking the conversion to the projector and I believe my perceptions were from a cell perspective however that was all that was needed to drive the car.

    Why did the one second at the intersection seem so long?

    It’s just a theory I’ve been considering but if I was operating at the cell level a thousand years as a day 2 Peter 3:8 would mathematically equate that one second to about two days and four hours. If everything in the Universe is trinary, down to three quarks in a proton and a neutron, consider the universe runs in three space-time continuums like a computer. William Lane Craig, in my prior post-comment-248003, was certainly proposing a solution to quantum field theory space-time that respected Lorentz transformation symmetry.

    • Machine (0, 1) (+, – energy) 3rd generation – spirit – information so far & future
    possibilities
    • Assembler……………………………..2nd generation – soul – operating system – perceptions
    of so far
    • High level……………………………….1st generation – body – actualities – pixel conversions
    (Utilizing perceptions) – to material

    In reading ‘Psychiatry, Psychoanalysis, and The New Biology of Mind’ Eric talks about a study done by David Hubel and Torsten Wiesel, for which they later won a Nobel Prize in medicine, where people like me having amblyopia, a lazy eye; in so long as my left eye is open my right eye is closed, (non-binocular) and because of that the pixels I intake are, (monocular closure), a shadow of, a limited set of pixels of normal reality.

    I consider in the shadow of, a limited 30% set of pixels, the patterns stick out and so I was somewhat savant in the area of pattern recognition which by the way is a right hemisphere artistic (Divergent) skill.

    Right hemisphere thinking stems from the left side of the body (with the one exception) that both eyes give shared input to a given hemisphere. So somehow epigenetically I also had (Lateral) “out of the box” skills that as Cercatore said: “to see the statistical logic and requisite beauty”.

    My kindergarten teacher noticed a city block drawing I had done in perfect one-point perspective and showed it to my mom saying this is not normal for a five-year-old. It was of the American Hoist complex on the Robert street bridge, where my dad worked, that I held in memory, from that morning, when my mom dropped him off. “ I was a good copier

    Consider the following string of machine level, binary code, characters.
    01010111011010000110010101101110001000000110100101101110001000000111010001101000011001010010000001000011011011110111010101110010011100110110010100100000011011110110011000100000011010000111010101101101011000010110111000100000011001010111011001100101011011100111010001110011001000000110100101110100

    By the way when I started working this was a core dump the only clue you got when your coding syntax was in error so I needed to learn to read this binary conversion of the American Standard Code for Information Interchange (ASCII) which, in the case above, translates to the first words of the Declaration of Independence (“When in the course of human events…”).

    Consider the following string of Assembler level, genetic code.
    AGTCTGGGACGCGCCGCCGCCATGATCATCCCTGTACGCTGCTTCACTTGTGGCAAGATCGTCGGCAACAAGTGGGAGGCTTACCTGGGGCTGCTGCAGGCCGAGTACACCGAGGGGTGAGGCGCGGGCCGGGGCTAGGGGCTGAGTCCGCCGTGGGGCGCGGGCCGGGGCTGGGGGCTGAGTCCGCCCTGGGGTGCGCGCCGGGGCGGGAGGCGCAGCGCTGCCTGAGGCCAGCGCCCCATGAGCAGCTTCAGGCCCGGCTTCTCCAGCCCCGCTCTGTGATCTGCTTTCGGGAGAACC

    This string of characters is not just a random assortment of the four letters A, T, G, and C, but a representation of part of the sequence of genetic assembly instructions for building a protein machine—an RNA polymerase—critical to gene expression (or information processing) in a living cell.

    These first two levels function well on their own, as spirit business – one of my prior posts, with the second, affected from the third level only by what gets stuffed down the throat and the emotional state [fight-or-flight / (clouds) or immune/ (shining) system].

    The 1st High level needs to consider emotions and is therefore not automatic and thus subject to error and definitely not programmable using a less than carrot-brained computer.

    The light that comes from stars doesn’t do so as the result on a chemical reaction but as the result of nuclear fusion. A star is essentially a contracted hydrogen cloud, and if the hydrogen cloud has contracted sufficiently, the pressure in its common center of gravity overwhelms the forces that hold individual hydrogen atoms together. Every four such hydrogen atoms combine into one helium atom, and since it takes less energy to hold one helium atom together than four hydrogen atoms, the difference is radiated out in the form of light. Stars burn through their hydrogen and then start compacting helium into even heavier elements until the star’s core is solid iron (with an atomic number of 26). When that happens, the star goes Super Nova exploding violently. In an instant, its outer corona forms all elements heavier than iron (including copper, atom number 29, silver, 47, and gold, 79), which blow out into space. If the star was massive enough, its inner mass collapses into a black hole (and if not, it becomes a very dense and very dead ball of neutrons).

    Some ideas taken from my reading interpretations of Abarim-publications:

    Within a black hole, the realities of space-time terminate: time slows down to a standstill and distance becomes infinite. That means that a black hole becomes a kind of duplicate of the entire universe, an equal in a way, a curious local infinity upon whose singularity the entire eternity of its surrounding space-time is instantaneously projected. With the ancients, Black holes were considered living, mental and intelligent hence, spoken of as a living and intelligent “host of heaven” (Deuteronomy 4:19, 1 Kings 22:19, Nehemiah 9:6, Isaiah 24:21, Daniel 8:10).

    Six days:

    Matter starts as photonic energy (day 1), goes through a matter-antimatter breach (day 2), after which antimatter is heard from no more and regular matter forms atoms (day 3), and then stars (day 4), and the various formative signals that come from stars (day 5) and finally DNA (at the close of day 6).

    Mind, likewise, starts with general consciousness (day 1), a breach between self-awareness and the so-called Theory of Mind (day 2), the rejection of self-centeredness in favor of the formation of social molecules (day 3), the formation of social stratification and leadership (day 4), a common culture (day 5), and finally a shared language and collective wisdom (day 6).

    The 1st High level:

    A word is only a word when everybody agrees on it, and that means that in order to exist, words don’t only require anatomical capabilities, but rather social capabilities. A word is what very large groups of interacting humans agree on how to call a thing. It takes a large multitude of freely interacting humans a long time of imitating each other to finally settle upon a consensus on what to call a thing. And when within that consensus, within that common center of gravity, agreeing on how to call that thing; there a mental equivalent of that thing begins to exist in a very real way, existing as a singular entity simultaneously within the conscious minds of those agreeing.

    We like to think that the progress of a society can be measured by the level of its technological sophistication, but if the laws of nature are anything to go on, societal progress can be measured by the level of unification of its individuals. Language is in fact a stellar phenomenon and the verbal reality that allows us, humans, our celebrated consciousness to work very much like the universe that allows a star to start shining.

    Even though the realm of words exists within heads that are obviously separated in space, the words themselves exist simultaneously within many heads at once and are therefore in no way separated but a continuum. People think of things because of the words in their heads and since these same words exist simultaneously in other people’s heads, it’s very difficult to think of wholly new and unique things.
    Most new and surprising ideas always exist in some form or other in many heads at once.

    Dan “For as much as we exalt artists, art emerges mostly from an arbitrary process of actualizing possibilities that haven’t been actualized yet”. Actually, everything works that way and pretty much how I discovered solutions to IT tech problems.

    Caricature You said, “we reach into the ‘Prima Material of the universe and extract out that which we find desirable for facilitating outwardly our internal necessity.”

    Consider the Prima Material to be like morphic-fields of self-organizing wholes with both a spatial and a temporal aspect organizing Spatio-temporal patterns by attracting the systems under their influence towards characteristic forms and patterns of activity, whose coming-into-being they organize and whose integrity they maintain interrelating and coordinating the morphic units or holons that lie within them, a nested hierarchy of probability. They contain a built-in cumulative memory given by self-resonance with their own past and by morphic resonance with all previous similar systems as the more often particular patterns of activity are repeated, the more habitual they tend to become.

    Spiritual inter-connected realms of power both patterns of this world and patterns of the kingdom with levels 3 and 2 functioning well however level 1 is in need of now moment, new birth and spiritual transformation.

    These patterns are the basic shape of a giant fractal, and each stage (matter, life, mind, global society, and so on) is on a course in alignment with the days of creation.

    A fractal, which is a shape, repeats certain patterns at different levels of complexity but is nevertheless governed by a single and relatively simple process. The separate instances or manifestations of this single process are called self-similar: the emergence of language from synchronous grunting to contraptions like “antidisestablishmentarianism”, the emergence of elements and molecules from helium to DNA, and the emergence of writing from the first scratched symbols to a Sonnet, are all self-similar.

    All these processes are governed by the same general principles, which in turn add up to a single process with six distinct stages. Every closed, or semi-closed, a system that evolves naturally must always evolve by this general pattern, which the Torah lays out in the creation week the basic pattern in which anything that evolves must evolve.

    The reality which the Bible describes is based on a vast fractal pattern, and the Bible is able to describe this fractal by being a fractal itself. The narrative of the Bible is carried by so-called meta-narratives, which are basic stories that are repeated on different levels of the main story’s development. The ancients realized that mathematics, (a right-handed Convergent prison of theological propositions requiring analysis or systems of thought), is NOT the language of nature. Rather the repetition of patterns — also known as “parables”, (Divergent left-handed mystery) pictures, images, and poetry, (Psalm 78:2, MATTHEW 13:3) — and all progression or evolution is a matter of broken symmetries within those repetitions.

    I enjoyed Greg’s sermon on fake news.

    Today I practiced squatting low and tucking my head down while picking raspberries. I found today that when you pick a good portion drop them off before you can pick them. Keeping my nose to the ground at times as I picked I discovered them and had an exceedingly bountiful harvest and I loosened up.

    I wholly agree that the patterns of this world, falsely weighted and unequal measured, consumer-based economies (right-handed in nature) need to be replaced by a resource managed with justice and mercy, (NOT so much liberty as in free market capitalism then only 2nd justice), for all economy.

    The problem of right-handed overthinking:

    It is easier to oversimplify the times into a good versus evil plotline, believing the “other” is always evil and we are always good, creating scapegoats and formulating enemies who are more like caricatures than actual humans, representatives of evil, rather than complex people.

    It’s effortless to make those we don’t understand fit into perceived depraved and immoral narratives. Because when the evil is always “out there” or in “them” we can avoid the painstakingly tedious work of acknowledging and drawing out the evil in ourselves. Matthew 7:5

    A life of narratives keeps the roles we play simplistic: We are good and they are bad.

    Sarah Bauer Anderson

    First and foremost let’s be partisans of a king who established an upside down, inside out, left-handed, born again spirit birth, follow Jesus orbiting God’s example kingdom, the others first kingdom, the go to the back of the line kingdom, the do for others what they can’t do for themselves kingdom.

    Hopefully, this post translates well. The Grammatically spell checker was freaking out fixing errors before they actually occurred.

  4. Gary says:

    Your comments on the environment are so wrong. Take time to look at history. Your wokness is unbelievable. Just because you stand on the stage and raise your voice doesn’t make it right. In Genesis he told us to eat meat. You miss quoted Revelation 11. Your going tone held accountable for the messages you preach.

  5. Jerry says:

    Gary the environment: Not sure where you’re coming from “so wrong” seems pretty extreme. I’ve got some thoughts but first I wanted to address the grand scheme of where I think Jewish folk fit today. It may or may not connect to your thoughts.

    In 1938 Jewish Nobel lariat Eric Kandell and his family fled Vienna Austria. This same Eric, from my last comment, reflecting said “my people have never been a nation so in that absence of being a people of power we decided to instead strive to be the smartest pursuing knowledge and wisdom”.

    Early physicists divided the world into matter and thought, and later, matter and energy. Each member of those pairs was considered to be entirely separate from the other, a mind/matter duality, shaping the early worldview as predetermined. People could do little to change things through actions or thoughts. The study of matter was science (always matter, never mind) whereas the mind was God’s instrument, so the study of religion (always mind, never matter). Descartes solidified the universe as a machine, with a set of laws stating that human beings could precisely determine, calculate, and predict the orderly ways in which the physical world would operate. The “classical” Newtonian physics model considered all things solid. Energy could be explained as a force to move objects or to change the physical state of matter.

    Since the seventeenth century, when religion and science went their separate ways, we have assumed that the truths and stories of one are incompatible with the truths and stories of the other. The result has been a kind of schizophrenic existence in which we compartmentalize our experience and hope that there will be no clashes that break our carefully constructed categories or expose our illusions. We live and work in a world in which science speaks one version of the truth while we believe and pray in a world in which religion speaks another. To live and work in one world and believe and pray in another makes our lives seem fragmented and disconnected, even alienated from what is truly life-giving.

    At the turn of the century the Cartesian/Newtonian reductionist watchmaker view, what we see, was perceived as 100% of reality with one small problem to be solved concerning the strange rotation of the planet Mercury around the Sun. What happened in the process of resolving that one small problem was Relativity eliminated the Newtonian illusion of absolute space and time; Quantum Theory eliminated the Newtonian dream of a controllable measurement process and Chaos eliminates the Euclidean Laplacian Cartesian fantasy of deterministic predictability.

    We become what we think is now 85% of reality, discontinuous, inhomogeneous, and irregular.

    Today, the quantum understanding, we are part of a vast invisible field of energy that contains all possible realities and responds to our thoughts and feelings. Thoughts have consequences that create your reality. All matter is more “no-thing” (energy) than “some-thing” (particles).

    The truth is that all the energy that would ever form the whole universe zipped into existence at once. Then it swiftly rushed through a series of symmetry breaches, produced nucleons, had a glorious moment of hydrogen formation, and spent the rest of its existence rearranging the same things over and over. Minute differences in initial energy distribution lead to the formation of huge stars. These burned out, imploded, and evaporated, and their clouds of ashes wafted out into space, contracted, and formed multiple smaller stars, planets, and other stuff us.

    The universe is mostly simple, it’s mostly empty, and matter is mostly hydrogen and radiation. But it also contains some swirls of really complicated molecules. That’s because, even for the universe, complicated things are harder to make than simple ones, and thus there are very few complicated things and an overwhelming mass of really simple ones. A bacterium is precisely as complicated as a human being. Their genomes are of different sizes but precisely as complex and in the world of genetics, size says little. The biggest genomes we know of belong to plants.

    The Nobel Prize is an annual, international prize first awarded in 1901 for achievements in Physics, Chemistry, Physiology or Medicine, Literature, and Peace. An associated prize in Economics has been awarded since 1969.

    Nobel Prizes have been awarded to over 850 individuals, of whom at least 27% (or without the peace prize over 34%) were Jews. Although Jews comprise less than 0.2% of the world’s population (or 1 in every 500 people), overall, they have won a total of 26% of all the Nobel Prizes in economics, 39% of medicine, 41% of Physics, 31% of Chemistry, 19% of Literature and 11% of all peace awards.

    Concerning Relativity and Quantum Theory the 3 key players, each winning a Noble Prize, were Jewish.

    Albert Einstein (1921) for his services to Theoretical Physics, and especially for his discovery of the law of the photoelectric effect.

    Niels Bohr (1922) for his services in the investigation of the structure of atoms and of the radiation emanating from them.

    Wolfgang Pauli (1945) for the discovery of the Exclusion Principle, also called the Pauli principle.

    Four Jewish Scientists Awarded 2013 Nobel Prizes in Chemistry and Physics (Higgs boson)

    2016 Nobel Prize Literature Bob Dylan born Robert Zimmerman and raised in a tight Jewish community in Hibbing, Minnesota. “It may be the devil or it may be the Lord but you gotta serve somebody”.

    The Fields Medal and the Abel Prize are the mathematician’s Nobel Prizes. For Chaos theory (2014), a Jew, Yakov Grigorevich for his fundamental contributions to complex dynamical systems, ergodic theory, and mathematical physics won.

    Consider God had a plan, after a seven-year war ending in 70 AD when the Temple was destroyed, to make the Jews the prototype of this new servant to one another kingdom of consciousness heaven and we should take heed likewise and pursue the kingdom of consciousness – frontal lobe activity.

    Sadly though a good chunk of folk don’t embrace this new science and therefore for the most part still live in this classical paradigm of two disconnected worlds that suggests a gradual and linear ascent from simple to complicated. This old idea suggests that the universe started out exceeding simple and then, by sheer accident, proceeded to become more complicated, until one day it was so complicated that it could accidentally produce simple life forms that then evolved into more complicated ones until ultimately, life produced very dumb homo sapiens who then proceeded to accidentally get slowly smarter and much better informed until they finally achieved levels of unprecedented glory which they invested into the willful invention of the smart-phone.

    Some folk argue the kingdom of heaven is at hand while others argue NO only after the rapture and a 7-year tribulation where the Jewish folk, in the absence of the church, proclaim the Kingdom.

    Kind of seems to me that’s what the Jewish folk have been doing a pretty good job of for the last century.

    The environment.

    Some folk believe that Jesus is going to return very soon to snatch his followers out of the world, destroy the earth, and whisk his people away to live with him in the heavenly clouds forever. So what’s the point, why waste time polishing the brass on a sinking ship? I thought that for a long time but have changed my opinion but I could be wrong!

    This was accredited to Martin Luther: “If I knew that tomorrow was the end of the world, I would plant an apple tree today.” There are folk, Greg included, that believe Jesus will not be returning to destroy but to renew. He will not return to the earth to say, “Away with this irredeemable thing! Let’s start over.” Rather, he will come again to the world that he made, and he will renew it completely with the same power that raised him from the dead. Nothing is beyond the reach of his redemption. He did say, “I am making all things new” (Rev. 21:5).

    The central point is that long-term projects aimed at cultural renewal are worth our time and our efforts and our prayers, whether or not Jesus returns in the very near future.

    If Jesus returns tomorrow, we have every reason to believe that whatever little we accomplished today (may) somehow be retained, absorbed, and transmuted into a God-glorifying reality in that future world. Paul tells us, “Your work (in the Lord) is not in vain” (1 Cor. 15:58).

    But if Jesus delays his return for another thousand years (maybe more!), then we’ll not be guilty of fleeing for lifeboats when the ship could have been saved. This sort of faith in Jesus’ future work frees us from a frantic life of “searching for signs of the end times,” to devote ourselves wholly and patiently to projects that may not be completed in our lifetimes.

    So why not, instead of speculating, hedge an equal position on the long and short and plant a tree.

    If nothing else tree leaves, through a process called photosynthesis, pull in carbon dioxide and water and use the energy of the sun to convert this into chemical compounds such as sugars that feed the tree, and as a by-product of that chemical reaction oxygen is produced and released by the tree.

    I’ve got some other thoughts from science but I’ll wait to comment. I’m interested in seeing other folk’s ideas first.

  6. etellewyn@gmail.com says:

    OMG what a great sermon. I wish more churches would preach this message. Thank you so much for talking about this!

  7. S says:

    Thanks for the uplift. I’ve been stuck inside the Fake News of my inner voice – self-judgment, self-condemnation, self-slander, throwing in the towel, giving up. You’ve encouraged me to rethink and re-evaluate, to stand up against my inner accusations. My worst enemy is my own self and he’s been hammering me pretty hard. Your words encourage a reset.
    Oh, and I’ve been checking out the yoga. Not nearly so intimidating as I imagined it would be.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

*

 

testimonial-icon

"Thank you, Woodland Hills! I’ve struggled in churches but your teachings answer so many questions and make so much sense."

– Sally